Have questions? Visit https://www.reddit.com/r/SNPedia

rs876660118

From SNPedia

ClinVar
Risk
Alt
Reference Rs876660118(AAAAGCAAGAGAATTTGAGAAGATGA;AAAAGCAAGAGAATTTGAGAAGATGA)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene FBXO11 MSH6
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 0
HGVS NC_000002.11:g.48033744_48033769del26
CLNSRC
CLNACC RCV000217290.1,