rs267607656
From SNPedia
| Orientation | minus |
| Stabilized | minus |
| Make rs267607656(-;-) |
| Make rs267607656(-;CATCGACGATGGAGGCCTCGG) |
| Make rs267607656(CATCGACGATGGAGGCCTCGG;CATCGACGATGGAGGCCTCGG) |
| Reference | GRCh38.p7 38.3/150 |
| Chromosome | 12 |
| Position | 52675451 |
| Gene | KRT1 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs267607656 |
| dbSNP (classic) | rs267607656 |
| ClinGen | rs267607656 |
| ebi | rs267607656 |
| HLI | rs267607656 |
| Exac | rs267607656 |
| Gnomad | rs267607656 |
| Varsome | rs267607656 |
| LitVar | rs267607656 |
| Map | rs267607656 |
| PheGenI | rs267607656 |
| Biobank | rs267607656 |
| 1000 genomes | rs267607656 |
| hgdp | rs267607656 |
| ensembl | rs267607656 |
| geneview | rs267607656 |
| scholar | rs267607656 |
| rs267607656 | |
| pharmgkb | rs267607656 |
| gwascentral | rs267607656 |
| openSNP | rs267607656 |
| 23andMe | rs267607656 |
| SNPshot | rs267607656 |
| SNPdbe | rs267607656 |
| MSV3d | rs267607656 |
| GWAS Ctlg | rs267607656 |
| Max Magnitude | 0 |
[PMID 29028840
] Polymorphism of keratin 1 associates with systemic lupus erythematosus and systemic sclerosis in a south Chinese population.
