rs3831317
From SNPedia
| Orientation | plus |
| Stabilized | plus |
| Make rs3831317(-;-) |
| Make rs3831317(-;AGACCATGGCCCCGCCCAGTCCCT) |
| Make rs3831317(AGACCATGGCCCCGCCCAGTCCCT;AGACCATGGCCCCGCCCAGTCCCT) |
| Reference | GRCh38.p2 38.2/144 |
| Chromosome | 1 |
| Position | 203217846 |
| Gene | CHIT1 |
| is a | snp |
| is | mentioned by |
| dbSNP | rs3831317 |
| dbSNP (classic) | rs3831317 |
| ClinGen | rs3831317 |
| ebi | rs3831317 |
| HLI | rs3831317 |
| Exac | rs3831317 |
| Gnomad | rs3831317 |
| Varsome | rs3831317 |
| LitVar | rs3831317 |
| Map | rs3831317 |
| PheGenI | rs3831317 |
| Biobank | rs3831317 |
| 1000 genomes | rs3831317 |
| hgdp | rs3831317 |
| ensembl | rs3831317 |
| geneview | rs3831317 |
| scholar | rs3831317 |
| rs3831317 | |
| pharmgkb | rs3831317 |
| gwascentral | rs3831317 |
| openSNP | rs3831317 |
| 23andMe | rs3831317 |
| SNPshot | rs3831317 |
| SNPdbe | rs3831317 |
| MSV3d | rs3831317 |
| GWAS Ctlg | rs3831317 |
| Max Magnitude | 0 |
[PMID 26332238
] A Polymorphism in the Chitotriosidase Gene Associated with Risk of Mycetoma Due to Madurella mycetomatis Mycetoma-A Retrospective Study
