rs3842570
Orientation | plus |
Stabilized | plus |
Make rs3842570(-;-) |
Make rs3842570(-;C) |
Make rs3842570(C;C) |
Reference | GRCh38 38.1/141 |
Chromosome | 2 |
Position | 240594876 |
Gene | CAPN10 |
is a | snp |
is | mentioned by |
dbSNP | rs3842570 |
dbSNP (classic) | rs3842570 |
ClinGen | rs3842570 |
ebi | rs3842570 |
HLI | rs3842570 |
Exac | rs3842570 |
Gnomad | rs3842570 |
Varsome | rs3842570 |
LitVar | rs3842570 |
Map | rs3842570 |
PheGenI | rs3842570 |
Biobank | rs3842570 |
1000 genomes | rs3842570 |
hgdp | rs3842570 |
ensembl | rs3842570 |
geneview | rs3842570 |
scholar | rs3842570 |
rs3842570 | |
pharmgkb | rs3842570 |
gwascentral | rs3842570 |
openSNP | rs3842570 |
23andMe | rs3842570 |
SNPshot | rs3842570 |
SNPdbe | rs3842570 |
MSV3d | rs3842570 |
GWAS Ctlg | rs3842570 |
Max Magnitude | 0 |
[PMID 19752882] Association of calpain-10 gene polymorphism and posttransplant diabetes mellitus in kidney transplant patients medicated with tacrolimus
[PMID 20470430] Common polymorphisms of calpain-10 and the risk of Type 2 Diabetes in a Tunisian Arab population: a case-control study
[PMID 14730479] Are variants in the CAPN10 gene related to risk of type 2 diabetes? A quantitative assessment of population and family-based association studies.
[PMID 19387820] Genetic polymorphisms of FSHR, CYP17, CYP1A1, CAPN10, INSR, SERPINE1 genes in adolescent girls with polycystic ovary syndrome.
[PMID 20667559] Association of calpain 10 gene polymorphisms with type 2 diabetes mellitus in Southern Indians.
ClinVar | |
---|---|
Risk | rs3842570(GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT;GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT) |
Alt | rs3842570(GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT;GATGATTCTGTCCCAGGAGCCGGGAGGAGGGT) |
Reference | rs3842570(-;-) |
Significance | Other |
Disease | Diabetes mellitus type 2 |
Variation | info |
Gene | CAPN10 |
CLNDBN | Diabetes mellitus type 2 |
Reversed | 0 |
HGVS | NC_000002.11:g.241534262_241534293dup32 |
CLNSRC | OMIM Allelic Variant |
CLNACC | RCV000005399.3, |