Have questions? Visit https://www.reddit.com/r/SNPedia

rs118203557

From SNPedia

ClinVar
Risk rs118203557(;)
Alt rs118203557(;)
Reference rs118203557(CAGTGCTGATGAAAGCCCTGCGG;CAGTGCTGATGAAAGCCCTGCGG)
Significance Pathogenic
Disease Tuberous sclerosis 1 Tuberous sclerosis syndrome
Variation info
Gene TSC1
CLNDBN Tuberous sclerosis 1 Tuberous sclerosis syndrome
Reversed 1
HGVS NC_000009.11:g.135781263_135781285del23
CLNSRC OMIM Allelic Variant Tuberous sclerosis database (TSC1)
CLNACC RCV000005407.2, RCV000054946.1,


[PMID 9242607] Identification of the tuberous sclerosis gene TSC1 on chromosome 9q34.


[PMID 10227394OA-icon.png] Mutational spectrum of the TSC1 gene in a cohort of 225 tuberous sclerosis complex patients: no evidence for genotype-phenotype correlation.