Have questions? Visit https://www.reddit.com/r/SNPedia

rs121908804

From SNPedia

Cystic Fibrosis related
Orientationplus
Stabilizedplus
Geno Mag Summary
(-;AGGGAGAATGATGATGAAGTAC) 3 carrier of a cystic fibrosis allele
(AGGGAGAATGATGATGAAGTAC;AGGGAGAATGATGATGAAGTAC) 0 common in clinvar


Make rs121908804(-;-)
ReferenceGRCh38 38.1/141
Chromosome7
Position117535388
GeneCFTR
is asnp
is mentioned by
dbSNPrs121908804
ebirs121908804
HLIrs121908804
Exacrs121908804
Varsomers121908804
Maprs121908804
PheGenIrs121908804
hapmaprs121908804
1000 genomesrs121908804
hgdprs121908804
ensemblrs121908804
gopubmedrs121908804
geneviewrs121908804
scholarrs121908804
googlers121908804
pharmgkbrs121908804
gwascentralrs121908804
openSNPrs121908804
23andMers121908804
23andMe allrs121908804
SNP Nexus

SNPshotrs121908804
SNPdbers121908804
MSV3drs121908804
GWAS Ctlgrs121908804
Max Magnitude3

Cystic fibrosis; c.720_741delAGGGAGAATGATGATGAAGTAC or Gly241Glufs


ClinVar
Risk rs121908804(;)
Alt rs121908804(;)
Reference rs121908804(AGGGAGAATGATGATGAAGTAC;AGGGAGAATGATGATGAAGTAC)
Significance Pathogenic
Disease Cystic fibrosis
Variation info
Gene CFTR
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117175442_117175463del22
CLNSRC CFTR2 OMIM Allelic Variant
CLNACC RCV000007565.5,