Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508136

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;CGAGAGACCATGCAGAGGTCGCC) 3 carrier of a cystic fibrosis allele
(CGAGAGACCATGCAGAGGTCGCC;CGAGAGACCATGCAGAGGTCGCC) 0 common in clinvar


Make rs397508136(-;-)
ReferenceGRCh38 38.1/141
Chromosome7
Position117480086
GeneCFTR
is asnp
is mentioned by
dbSNPrs397508136
ebirs397508136
HLIrs397508136
Exacrs397508136
Varsomers397508136
Maprs397508136
PheGenIrs397508136
hapmaprs397508136
1000 genomesrs397508136
hgdprs397508136
ensemblrs397508136
gopubmedrs397508136
geneviewrs397508136
scholarrs397508136
googlers397508136
pharmgkbrs397508136
gwascentralrs397508136
openSNPrs397508136
23andMers397508136
23andMe allrs397508136
SNP Nexus

SNPshotrs397508136
SNPdbers397508136
MSV3drs397508136
GWAS Ctlgrs397508136
Max Magnitude3
ClinVar
Risk rs397508136(;)
Alt rs397508136(;)
Reference rs397508136(CGCCCGAGAGACCATGCAGAGGT;CGCCCGAGAGACCATGCAGAGGT)
Significance Pathogenic
Disease Cystic fibrosis
Variation info
Gene CFTR
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117120140_117120162del23
CLNSRC CFTR2
CLNACC RCV000046190.3,