Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;CGAGAGACCATGCAGAGGTCGCC) 3 carrier of a cystic fibrosis allele

Make rs397508136(-;-)
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
1000 genomesrs397508136
23andMe allrs397508136
SNP Nexus

GWAS Ctlgrs397508136
Max Magnitude3
Significance Pathogenic
Disease Cystic fibrosis
Variation info
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117120140_117120162del23
CLNACC RCV000046190.3,