Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs104886393

From SNPedia

ClinVar
Risk rs104886393(-;-)
Alt rs104886393(-;-)
Reference Rs104886393(CCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAA;CCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAA)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107911654_107911705del52
CLNSRC ClinVar
CLNACC RCV000021553.1,


[PMID 8648925] The COL4A5 gene in Japanese Alport syndrome patients: spectrum of mutations of all exons. The Japanese Alport Network.