Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057516627

From SNPedia
ClinVar
Risk rs1057516627(-;-)
Alt rs1057516627(-;-)
Reference Rs1057516627(TTTTAGCTCTGTGGGTGCCCTGGAGGGC;TTTTAGCTCTGTGGGTGCCCTGGAGGGC)
Significance Probable-Pathogenic
Disease Pyknodysostosis
Variation info
Gene CTSK
CLNDBN Pyknodysostosis
Reversed 1
HGVS NC_000001.10:g.150776665_150776692del28
CLNSRC
CLNACC RCV000411707.1,