Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057518043

From SNPedia

ClinVar
Risk rs1057518043(-;-)
Alt rs1057518043(-;-)
Reference Rs1057518043(TCGACCCAAAGAGGACACACAG;TCGACCCAAAGAGGACACACAG)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene FLCN
CLNDBN not provided
Reversed 1
HGVS NC_000017.10:g.17117110_17117131del22
CLNSRC
CLNACC RCV000413653.1,