Have questions? Visit https://www.reddit.com/r/SNPedia

rs1057519844

From SNPedia
ClinVar
Risk rs1057519844(-;-)
Alt rs1057519844(-;-)
Reference Rs1057519844(AAGATTGGAACTAGGTCAGC;AAGATTGGAACTAGGTCAGC)
Significance Probable-Pathogenic
Disease Neoplasm
Variation info
Gene APC
CLNDBN Neoplasm
Reversed 0
HGVS NC_000005.9:g.112175219_112175238delAAGATTGGAACTAGGTCAGC
CLNSRC
CLNACC RCV000418174.1,