Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064792900

From SNPedia

ClinVar
Risk rs1064792900(-;-)
Alt rs1064792900(-;-)
Reference Rs1064792900(CACTTACTCTTGGGCAGGTA;CACTTACTCTTGGGCAGGTA)
Significance Pathogenic
Disease Hereditary leiomyomatosis and renal cell cancer
Variation info
Gene FH
CLNDBN Hereditary leiomyomatosis and renal cell cancer
Reversed 1
HGVS NC_000001.10:g.241671900_241671919del20
CLNSRC
CLNACC RCV000445593.1,