Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064792915

From SNPedia

ClinVar
Risk rs1064792915(-;-)
Alt rs1064792915(-;-)
Reference Rs1064792915(GCCTTGAAAGCCAATGTAGATGGCTTAT;GCCTTGAAAGCCAATGTAGATGGCTTAT)
Significance Probable-Pathogenic
Disease Dilated cardiomyopathy 1G
Variation info
Gene TTN TTN-AS1
CLNDBN Dilated cardiomyopathy 1G
Reversed 1
HGVS NC_000002.11:g.179473007_179473034del28
CLNSRC
CLNACC RCV000466289.1,