Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064792934

From SNPedia
ClinVar
Risk rs1064792934(ATGGTGG;ATGGTGG)
Alt rs1064792934(ATGGTGG;ATGGTGG)
Reference Rs1064792934(CACTCCTCCCAAGGACACTTGTAGCCCGGAGC;CACTCCTCCCAAGGACACTTGTAGCCCGGAGC)
Significance Pathogenic
Disease Osler hemorrhagic telangiectasia syndrome
Variation info
Gene ENG
CLNDBN Osler hemorrhagic telangiectasia syndrome
Reversed 1
HGVS NC_000009.11:g.130586657_130586688del32insCCACCAT
CLNSRC
CLNACC RCV000464962.1,