Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064792984

From SNPedia

ClinVar
Risk rs1064792984(-;-)
Alt rs1064792984(-;-)
Reference Rs1064792984(CCCCAGCTCAGCAAGGTCAGCAGATC;CCCCAGCTCAGCAAGGTCAGCAGATC)
Significance Probable-Pathogenic
Disease Mental retardation
Variation info
Gene SYNGAP1
CLNDBN Mental retardation, autosomal dominant 5
Reversed 0
HGVS NC_000006.11:g.33409140_33409165del26
CLNSRC
CLNACC RCV000476459.1,