Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064793271

From SNPedia

ClinVar
Risk rs1064793271(-;-)
Alt rs1064793271(-;-)
Reference Rs1064793271(GGTCAGCCTGCCAGTATACTGGG;GGTCAGCCTGCCAGTATACTGGG)
Significance Pathogenic
Disease not provided
Variation info
Gene SMAD4
CLNDBN not provided
Reversed 0
HGVS NC_000018.9:g.48584496_48584518del23
CLNSRC
CLNACC RCV000481001.1,