Have questions? Visit https://www.reddit.com/r/SNPedia

rs1064794624

From SNPedia
Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Chromosome22
Position41169518
is asnp
is mentioned by
dbSNPrs1064794624
dbSNP (old)rs1064794624
ClinGenrs1064794624
ebirs1064794624
HLIrs1064794624
Exacrs1064794624
Gnomadrs1064794624
Varsomers1064794624
Maprs1064794624
PheGenIrs1064794624
Biobankrs1064794624
1000 genomesrs1064794624
hgdprs1064794624
ensemblrs1064794624
gopubmedrs1064794624
geneviewrs1064794624
scholarrs1064794624
googlers1064794624
pharmgkbrs1064794624
gwascentralrs1064794624
openSNPrs1064794624
23andMers1064794624
23andMe allrs1064794624
SNPshotrs1064794624
SNPdbers1064794624
MSV3drs1064794624
GWAS Ctlgrs1064794624
Max Magnitude0
ClinVar
Risk rs1064794624(CCTATGTATATCTCCTATACATATCTCCTATCGAACA;CCTATGTATATCTCCTATACATATCTCCTATCGAACA)
Alt rs1064794624(CCTATGTATATCTCCTATACATATCTCCTATCGAACA;CCTATGTATATCTCCTATACATATCTCCTATCGAACA)
Reference Rs1064794624(-;-)
Significance Pathogenic
Disease not provided
Variation info
Gene
CLNDBN not provided
Reversed 0
HGVS NC_000022.10:g.41565522_41565523insCCTATGTATATCTCCTATACATATCTCCTATCGAACA
CLNSRC
CLNACC RCV000487041.1,