Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064795867

From SNPedia

ClinVar
Risk rs1064795867(-;-)
Alt rs1064795867(-;-)
Reference Rs1064795867(CGCCGCGCGCCCCGAGCGCACCTGCCGCCCCCGCACG;CGCCGCGCGCCCCGAGCGCACCTGCCGCCCCCGCACG)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene GJC2
CLNDBN not provided
Reversed 0
HGVS NC_000001.10:g.228345821_228345857del37
CLNSRC
CLNACC RCV000484973.1,