Have questions? Visit https://www.reddit.com/r/SNPedia

rs121913313

From SNPedia
ClinVar
Risk rs121913313(-;-)
Alt rs121913313(-;-)
Reference Rs121913313(CTGCTTCCCTGAGGAGGAGAAGTGCTT;CTGCTTCCCTGAGGAGGAGAAGTGCTT)
Significance Probable-Pathogenic
Disease Medullary thyroid carcinoma
Variation info
Gene RET
CLNDBN Medullary thyroid carcinoma
Reversed 0
HGVS NC_000010.10:g.43609078_43609104delTTCCCTGAGGAGGAGAAGTGCTTCTGC
CLNSRC
CLNACC RCV000420537.1,