Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs267608333

From SNPedia

ClinVar
Risk rs267608333(-;-)
Alt rs267608333(-;-)
Reference Rs267608333(GAGAGCTCCGAGGACCCCACCAGCCC;GAGAGCTCCGAGGACCCCACCAGCCC)
Significance Pathogenic
Disease not provided Rett syndrome
Variation info
Gene MECP2
CLNDBN not provided Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296074_153296099del26
CLNSRC
CLNACC RCV000132948.1, RCV000445571.1,