Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs267608617

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;TCTGCAAAGAGGAGAAGATGCCCAGA) 6 Rett syndrome (if accurately called)
(TCTGCAAAGAGGAGAAGATGCCCAGA;TCTGCAAAGAGGAGAAGATGCCCAGA) 0 common in clinvar


Make rs267608617(-;-)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position154030568
GeneMECP2
is asnp
is mentioned by
dbSNPrs267608617
dbSNP (old)rs267608617
ClinGenrs267608617
ebirs267608617
HLIrs267608617
Exacrs267608617
Gnomadrs267608617
Varsomers267608617
Maprs267608617
PheGenIrs267608617
Biobankrs267608617
1000 genomesrs267608617
hgdprs267608617
ensemblrs267608617
gopubmedrs267608617
geneviewrs267608617
scholarrs267608617
googlers267608617
pharmgkbrs267608617
gwascentralrs267608617
openSNPrs267608617
23andMers267608617
23andMe allrs267608617
SNPshotrs267608617
SNPdbers267608617
MSV3drs267608617
GWAS Ctlgrs267608617
Max Magnitude6

aka c.1235_1260del26 (p.Val412Glyfs)

23andMe name: i5900852, however, they incorrectly assign the deletion genotype (D;D) as the normal genotype


ClinVar
Risk rs267608617(-;-)
Alt rs267608617(-;-)
Reference Rs267608617(TCTGCAAAGAGGAGAAGATGCCCAGA;TCTGCAAAGAGGAGAAGATGCCCAGA)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296019_153296044del26
CLNSRC
CLNACC RCV000132974.2,