Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs587781442

From SNPedia

ClinVar
Risk rs587781442(GACATTTTTCCTACCACTTC;GACATTTTTCCTACCACTTC)
Alt rs587781442(GACATTTTTCCTACCACTTC;GACATTTTTCCTACCACTTC)
Reference Rs587781442(-;-)
Significance Other
Disease Hereditary cancer-predisposing syndrome Tumor susceptibility linked to germline BAP1 mutations
Variation info
Gene MRE11A
CLNDBN Hereditary cancer-predisposing syndrome Tumor susceptibility linked to germline BAP1 mutations
Reversed 1
HGVS NC_000011.9:g.94169013_94169032dup20
CLNSRC
CLNACC RCV000129354.4, RCV000219080.1,