Have questions? Visit https://www.reddit.com/r/SNPedia

rs768265778(CTACTCATGGTGAGGGAGCT;CTACTCATGGTGAGGGAGCT)

From SNPedia

common in clinvar
Is agenotype
ofrs768265778
Gene
Chromosome17
Position65,558,613
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(CTACTCATGGTGAGGGAGCT;CTACTCATGGTGAGGGAGCT) 0 common in clinvar