Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1057517182

From SNPedia

ClinVar
Risk rs1057517182(-;-)
Alt rs1057517182(-;-)
Reference Rs1057517182(ACAGGAATGACAACTCACCCACTTTCAAG;ACAGGAATGACAACTCACCCACTTTCAAG)
Significance Probable-Pathogenic
Disease Usher syndrome
Variation info
Gene PCDH15
CLNDBN Usher syndrome, type 1F
Reversed 1
HGVS NC_000010.10:g.56128910_56128938del29
CLNSRC
CLNACC RCV000411523.1,