Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs1064792974

From SNPedia

ClinVar
Risk rs1064792974(-;-)
Alt rs1064792974(-;-)
Reference Rs1064792974(CGCCGCCGCTGCCGCCGCGGAACCCCCGG;CGCCGCCGCTGCCGCCGCGGAACCCCCGG)
Significance Pathogenic
Disease Retinoblastoma
Variation info
Gene LINC00441 RB1
CLNDBN Retinoblastoma
Reversed 0
HGVS NC_000013.10:g.48878085_48878113del29
CLNSRC
CLNACC RCV000462003.1,