rs80338725(-;GAGATTACAGGTGGCTGCCCGGG)
From SNPedia
Carrier of a citrullinemia/citrin deficiency allele |
Is a | genotype |
of | rs80338725 |
Gene | SLC25A13 |
Chromosome | 7 |
Position | 96,121,928 |
mentioned | by |
Magnitude | 3 |
Repute | Bad |
Geno | Mag | Summary |
---|---|---|
(-;-) | 0 | common in clinvar |
(-;GAGATTACAGGTGGCTGCCCGGG) | 3 | Carrier of a citrullinemia/citrin deficiency allele |
(GAGATTACAGGTGGCTGCCCGGG;GAGATTACAGGTGGCTGCCCGGG) | 5.7 | Citrullinemia type II/citrin deficiency; neonatal and/or adult-onset |
(GCT;GCT) | 0 | common in clinvar |
Unaffected in absence of a second SLC25A13 mutation; see ClinVar sidebar on main SNP page.