rs80338725(-;GAGATTACAGGTGGCTGCCCGGG)
From SNPedia
| Carrier of a citrullinemia/citrin deficiency allele |
| Is a | genotype |
| of | rs80338725 |
| Gene | SLC25A13 |
| Chromosome | 7 |
| Position | 96,121,928 |
| mentioned | by |
| Magnitude | 3 |
| Repute | Bad |
| Geno | Mag | Summary |
|---|---|---|
| (-;-) | 0 | common in clinvar |
| (-;GAGATTACAGGTGGCTGCCCGGG) | 3 | Carrier of a citrullinemia/citrin deficiency allele |
| (GAGATTACAGGTGGCTGCCCGGG;GAGATTACAGGTGGCTGCCCGGG) | 5.7 | Citrullinemia type II/citrin deficiency; neonatal and/or adult-onset |
| (GCT;GCT) | 0 | common in clinvar |
Unaffected in absence of a second SLC25A13 mutation; see ClinVar sidebar on main SNP page.
