Have questions? Visit https://www.reddit.com/r/SNPedia

rs62895363(-;23)

From SNPedia

Carrier of a phenylketonuria mutation
Is agenotype
ofrs62895363
GenePAH
Chromosome12
Position102,855,234
mentionedby
Magnitude3
ReputeBad
Geno Mag Summary
(-;23) 3 Carrier of a phenylketonuria mutation
(TCCTTGTATAAAACCCATGCTTG;TCCTTGTATAAAACCCATGCTTG) 0 common in clinvar

Phenylketonuria mutation carrier; unaffected unless a second PKU mutation is present.