Have questions? Visit https://www.reddit.com/r/SNPedia

rs62895363(TCCTTGTATAAAACCCATGCTTG;TCCTTGTATAAAACCCATGCTTG)

From SNPedia

common in clinvar
Is agenotype
ofrs62895363
GenePAH
Chromosome12
Position102,855,234
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;23) 3 Carrier of a phenylketonuria mutation
(TCCTTGTATAAAACCCATGCTTG;TCCTTGTATAAAACCCATGCTTG) 0 common in clinvar