Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs121908804(-;AGGGAGAATGATGATGAAGTAC)

From SNPedia
carrier of a cystic fibrosis allele
Is agenotype
ofrs121908804
GeneCFTR
Chromosome7
Position117,535,388
mentionedby
Magnitude3
ReputeBad
Geno Mag Summary
(-;AGGGAGAATGATGATGAAGTAC) 3 carrier of a cystic fibrosis allele
(AGGGAGAATGATGATGAAGTAC;AGGGAGAATGATGATGAAGTAC) 0 common in clinvar

Cystic fibrosis mutation carrier; unaffected unless CF mutation present on other copy of CF gene