Have data from 23andMe or Ancestry? Make a report automatically with Promethease !


From SNPedia
Mucolipidosis III gamma
Is agenotype
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;GAGGATGCTGGCTACTTAAAGACCCCAG) 3 Carrier of a mucolipidosis III gamma mutation

See ClinVar sidebar on main rs/page for details.