Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs193302859(GAGGATGCTGGCTACTTAAAGACCCCAG;GAGGATGCTGGCTACTTAAAGACCCCAG)

From SNPedia
common in clinvar
Is agenotype
ofrs193302859
GeneGNPTG
Chromosome16
Position1,362,641
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;GAGGATGCTGGCTACTTAAAGACCCCAG) 3 Carrier of a mucolipidosis III gamma mutation
(GAGGATGCTGGCTACTTAAAGACCCCAG;GAGGATGCTGGCTACTTAAAGACCCCAG) 0 common in clinvar