Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs199475697(-;22)

From SNPedia
Carrier of a phenylketonuria mutation
Is agenotype
ofrs199475697
GenePAH
Chromosome12
Position102,855,229
mentionedby
Magnitude3
ReputeBad
Geno Mag Summary
(-;22) 3 Carrier of a phenylketonuria mutation
(TATAAAACCCATGCTTGCTATG;TATAAAACCCATGCTTGCTATG) 0 common in clinvar

Phenylketonuria mutation carrier; unaffected unless a second PKU mutation is present.