Have data from 23andMe or Ancestry? Make a report automatically with Promethease !

rs199475697(TATAAAACCCATGCTTGCTATG;TATAAAACCCATGCTTGCTATG)

From SNPedia
common in clinvar
Is agenotype
ofrs199475697
GenePAH
Chromosome12
Position102,855,229
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;22) 3 Carrier of a phenylketonuria mutation
(TATAAAACCCATGCTTGCTATG;TATAAAACCCATGCTTGCTATG) 0 common in clinvar