BRCA1
is a | gene |
is | mentioned by |
Full name | breast cancer 1, early onset |
EntrezGene | 672 |
PheGenI | 672 |
VariationViewer | 672 |
ClinVar | BRCA1 |
GeneCards | BRCA1 |
dbSNP | 672 |
Diseases | BRCA1 |
SADR | 672 |
HugeNav | 672 |
wikipedia | BRCA1 |
BRCA1 | |
gopubmed | BRCA1 |
EVS | BRCA1 |
HEFalMp | BRCA1 |
MyGene2 | BRCA1 |
23andMe | BRCA1 |
UniProt | P38398 |
Ensembl | ENSG00000012048 |
OMIM | 113705 |
# SNPs | 2654 |
BRCA1 is a human tumor suppressor gene. Like most genes, variations in the BRCA1 gene can be either causal for a given disease, or associated with somewhat higher risk, or benign.
However, "causal" does not mean that there is a 100% certainty that a person with such a variant will develop the disease. For individuals with causal BRCA1 variations, a good clinical summary provided by OMIM states the disease odds as[1]:
- Mutation carriers have an increased risk of developing breast and/or ovarian cancer at an earlier age
- Lifetime risk of breast cancer in mutation carriers is 80 to 90%
- Lifetime risk of ovarian cancer in mutation carriers is 40 to 50%
- Increased risk of bilateral breast cancer
Similarly, a 2017 publication involving ~10,000 women over 20 years concluded that women with BRCA1 mutations have on average a 72% risk of developing breast cancer by the age of 80, and an average lifetime risk of ovarian cancer of 44%.[PMID 28632866]
There are over 500 BRCA1 variants that are considered causal, but almost all are very rare. It is estimated that all causal BRCA mutations combined occur in less than 1/3rd of 1% of people. Some of "slightly less rare" causal BRCA1 SNPs include:
- 185delAG BRCA1 i4000377 (II is normal; DD or DI are the mutations); dbSNP rs386833395 is probably the best representative; this is most prevalent in Ashkenazi Jews
- 5382insC BRCA1 i4000378 (DD is normal; II or DI are the mutations); known as rs80357906 in dbSNP and SNPedia; also most prevalent in Ashkenazi Jews
Other causal BRCA1 mutations include:
- rs28897696, known as A1708E, predicted to be highly linked & causative
- rs55770810, known as R1699W, predicted to be linked & causative
Many other variations of varying consequence are known. These include:
- rs1799950, known as Q356R
- rs4986850, known as D693N
- rs2227945, known as S1140G
- rs16942, known as K1183R
- rs1799966, known as S1613G
- rs41293463, known as M1775R
- rs1800709, known as R841W
- rs41293455, known as R1443G or R1443*
- rs4986852, known as S1040N
- rs28897672, known as C61G
This webpage from the Jackson Laboratory contains three important tips to know about direct-to-consumer BRCA1/2 testing.
This report from the NCI advises:
- The cost for genetic testing can range from several hundred to several thousand dollars.
- because the results of genetic tests can affect a person's health insurance coverage, some individuals may not want to use their insurance to pay for testing
- it can take several weeks or months for test results to become available
See also BRCA1 and BRCA2 for an extensive list of breast cancer related SNPs (including variations of all types from benign to causal).
- rs80357629 -/A
- rs80358145 A/G
- rs80357477 A/G
- rs80357558 -/C
- rs80357055 A/C
- rs80357069 A/G/T
- rs80357284 A/G
- rs80357590 -/C
- rs41293463 A/G/T
- rs80357823 -/C
- rs80357463 G/T
- rs80358150 A/G
- rs80357906 -/C
- rs80357925 -/A
- rs45553935 C/G/T
- rs80357975 -/GAAA
- rs80357347 A/T
- rs80358089 C/T
- rs80358053 A/G/T
- rs80187739 A/C/G/T
- rs80357061 C/G/T
- rs80357623 -/CTAAT
- rs80357862 -/CTAA
- rs80358086 C/G/T
- rs80358087 A/C/T
- rs80359876 -/CTGGCCTGACCCCAGAAGA
- rs80356862 C/G
- rs80357641 -/AG
- rs80357433 C/G
- rs80356988 A/C/G
- rs80358063 A/G
- rs80357389 A/G/T
- rs80357854 -/AA
- rs273900730 CTA/TT
- rs80357916 -/C
- rs80358027 A/G/T
- rs80357977 -/GT
- rs80357981 -/G
- rs80357071 C/G
- rs80357787 -/AG
- rs80357259 G/T
- rs80357804 -/TG
- rs80358070 A/G
- rs80358178 A/G
- rs80357508 -/TCAA
- rs80357711 -/A
- rs80357021 G/T
- rs80357318 C/T
- rs80357254 A/T
- rs80357889 -/TGAG
- rs80357993 -/AG
- rs80357848 -/A
- rs80357520 -/TA
- rs80357868 -/GTCT
- rs80357609 -/GTAAA
- rs80357162 G/T
- rs80357902 -/A
- rs80357729 -/A
- rs80357980 -/A
- rs62625308 C/G/T
- rs80357877 -/GAAGATACTAG
- rs80357509 -/A
- rs80357808 -/G
- rs80357018 G/T
- rs80357405 C/G
- rs80357945 -/GT
- rs80357903 -/CAAG
- rs80357624 -/GA
- rs80357635 -/AG
- rs80357511 -/G
- rs80357161 G/T
- rs80357846 -/A
- rs80357601 -/A
- rs80357829 -/AA
- rs80357115 G/T
- rs80357832 -/GATA
- rs80357035 G/T
- rs80357717 -/AT
- rs80357971 -/AA
- rs80357596 -/GAAA
- rs80357251 A/G/T
- rs80356925 C/G
- rs80357131 C/T
- rs80357607 -/C
- rs80357970 -/C
- rs80357669 -/C
- rs80357524 -/C
- rs80357664 -/AG
- rs80357786 -/A
- rs80357583 -/G
- rs80357654 -/CA
- rs80356875 A/G/T
- rs80357233 C/G
- rs80357880 -/T
- rs80357688 -/A
- rs80357853 -/A
- rs80357522 -/A
- rs80357355 A/T
- rs80357526 -/GAAA
- rs80356898 C/T
- rs80357600 -/A
- rs80357662 -/A
- rs80357908 -/C
- rs80357888 -/TTAAA
- rs80357010 C/T
- rs80357801 -/ATTA
- rs273897659 AA/G
- rs80357714 -/A
- rs80357969 -/AG
- rs80357597 -/G
- rs80359874 -/TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC
- rs80357612 -/C
- rs80357774 -/G
- rs80357569 -/A
- rs80357618 -/A
- rs80359872 -/CATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAA
- rs80357292 A/G
- rs80357844 -/A
- rs80357724 -/TT
- rs80357321 G/T
- rs80357747 -/GT
- rs80357941 -/T
- rs80358047 A/T
- rs80357887 -/CT
- rs80356991 A/G/T
- rs80357604 -/A
- rs80358011 A/C/T
- rs80358061 G/T
- rs80358163 A/G
- rs80358042 A/C/G/T
- rs80357382 A/G
- rs80357637 -/T
- rs80358158 C/G/T
- rs80357498 A/G
- rs80357443 G/T
- rs80357783 -/A